-- ,

--, , - , 5 (, &/?1, , III ).

---- 422 , -- , (. 19) (. 20) .

, 1- --- ( 1-7), 2- - (8-11), 3- - (12-14); 4- - (15-23); 5- - (24-26); 6- - (27-28), 7- - (29-42) 8- - (43-47) --- (. 19-20).

, 8- , - (225/94/87/32/6 ), . 2- ( BstY), 3- ( ) 5- (11 ) .

-- , . 2-4.

-- N031, . 2 ( 2-6) 15- (15) --- 4- , 115 (. 20), 25 , -, 1 .

-- N015 (. 2, 8-12) 17- ( 17) ---- 4- , 17 (. 20), 2 N061 /?-, ( N015, : 867143; N062, : 886615).

---

..

-

()

- ()

Sspl

III

001

1

-63

3808571

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

002

1

-167

3808575

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

003

1

-112

3808572

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

004

1

-220

1808576

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

005

1

-1

065652

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

006

1

1-2

065651

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

007

1

065646

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

008

1

-2

065640

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

009

1

08/176/

JN254640

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

010

1

09/197/8

254636

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

011

1

995174

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

012

1

485

151262

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

013

1

141

547184

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

014

1

-4315

3808589

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

015

1

-2

065653

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

016

1

-3556

1808588

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

017

1

-3252

1808585

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

018

1

-3222

1808584

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

019

1

-148

1808573

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

020

1

-3254

3808586

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

021

1

^

000647

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

022

1

-

35242

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

023

1

JSIA

065644

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

024

1

065641

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

025

1

913

600696

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

..

BLV

Gen Ban

A/N

-

(bp)

- (bp)

Pvull

Sspl

Hphl

Hae III

BstW

026

1

NB7

JQ686110

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

027

1

Isfahan

EU266061

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

028

1

Shahrekord

EU266060

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

029

1

Tehran

EU266063

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

030

1

Varamin

EU266064

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

031

1

EU266066

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

032

1

30

AF399703

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

033

1

CRAS-3

EF065637

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

034

1

JPKA-2

EF065659

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

035

1

JPKA-1

EF065658

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

036

1

JPAI-1

EF065657

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

037

1

UruL07IX

FM955576

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

038

1

UruL07VIII

FM955575

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

039

1

UruL07VI

FM955573

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

040

1

UruL07V

FM955572

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

041

1

UruL07II

FM955570

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

042

1

UruL07I

FM955569

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

043

1

UruC06III

FM955559

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

044

1

UruC06I

FM955557

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

045

1

UruLOl VIII

FM955547

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

046

1

UruLOlI

FM955540

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

047

1

UruL07VII

FM955574

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

048

1

UruL07III

FM955571

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

049

1

UruLOl IV

FM955543

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

050

1

USPA

EF065656

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

051

1

468-22

AY078387

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

052

1

Zanjan

EU266065

444

444

399/45

224 220

198 04 87 32 27 6

198/128/118

1

053

1

USWI

EF065642

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

..

BLV

GenBank

A/N

-

- (bp)

(bp)

Pvull

Sspl

Hphl

Hue III

BstW

054

1

Cow 527

AF007764

444

444

399/45

224/220

285/94/32/27/6

198/128/118

2

055

1

K02120

444

444

399/45

224/220

285/94/32/27/6

198/128/118

2

056

1

Cow 134

AF007763

444

444

399/45

224/220

285/94/32/27/6

198/128/118

2

057

1

JPMI-1

EF065660

444

444

399/45

224/220

285/94/32/27/6

198/128/118

2

058

1

029

AB099344

444

444

399/45

224/220

285/94/32/27/6

198/128/118

2

059

1

IW7

AB099338

444

444

399/45

224/220

285/94/32/27/6

198/128/118

2

060

1

JPMI-2

EF065661

444

444

399/45

224/220

285/94/32/27/6

198/128/118

2

061

1

JPMI-3

EF065662

444

444

399/45

224/220

285/94/32/27/6

198/128/118

2

062

1

23

U87873

444

444

399/45

224/220

312/94/32/6

198/128/118

3

063

1

AL-2106

FJ808578

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

064

1

Urul3

FM209475

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

065

1

Uru7

FM209474

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

066

1

Urul8

FM209473

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

067

1

Uru24

FM209472

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

068

1

Uru34

FM209469

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

069

1

UruL002I

FM955584

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

070

1

Uru9JD

FM955566

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

071

1

UrulRl

FM955563

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

072

1

UrullOO

FM955562

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

073

1

UruC06IV

FM955560

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

074

1

UruC05V

FM955556

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

075

1

UruC05III

FM955554

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

076

1

UruL03III

FM955551

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

077

1

UruL03I

FM955550

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

078

1

UruLOIX

FM955549

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

079

1

UruLOlIX

FM955548

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

080

1

UruLOl VII

FM955546

444

444

399 45

224/220

19S 94/87/32/27/6

246/198

4

081

1

UruLO 1 III

FM955542

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

..

BLV

GenBank

A/N

-

- (bp)

(bp)

Pvull

Sspl

Hphl

Hae III

BstW

K

082

1

UruLOHI

FM955541

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

083

1

UruLOlV

FM955544

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

084

1

UruC05IV

FM955555

444

444

499/45

224/220

198/94/87/32/27/6

246/198

4

085

1

UruC05II

FM955553

444

444

499/45

224/220

198/94/87/32/27/6

246/198

4

086

1

UruC06VI

FM955561

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

087

1

Uru8JD

FM955565

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

088

1

UrulR2

FM955564

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

089

1

Uru 11 JD

FM955568

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

090

1

UruC05I

FM955552

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

091

1

UruL09XXI

FM955583

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

092

1

32

DQ059418

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

093

1

UruLOl VI

FM955545

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

094

1

UruL09XI

FM955582

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

095

1

UruL09VI

FM955581

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

096

1

UruL09I

FM955577

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

097

1

UruL09II

FM955578

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

098

1

Uru 1 JD

FM955567

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

099

1

Uru38

FM209471

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

100

1

Uru33

FM209470

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

101

1

UruMC

FM209468

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

102

1

LSI

HE967301

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

103

1

LS2

HE967302

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

104

1

LS3

HE967303

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

105

1

UruC06II

FM955558

444

444

399/45

224/220

285/94/32/27/6

246/198

5

106

1

VdM

M35239

444

444

399/45

224/181/39

198/94/87/32/27/6

316/128

6

107

1

Kurdistan

EU266062

444

444

399/45

220/196/28

198/119/94/27/6

198/128/118

7

108

2

AL-164

FJ808574

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

109

2

LS-TSR2

FJ808597

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

..

BLV

Gen Ban

A/N

-

- (bp)

(bp)

Pvull

Sspl

Hphl

Hae III

BstW

K

2

LS-LS1

FJ808594

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

111

2

LS-GBA

FJ808593

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

112

2

PL-3371

FJ808587

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

113

2

PL-1042

FJ808581

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

114

2

19

AF257515

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

115

2

2771

AB099324

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

116

2

2761

AB099323

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

117

2

2715

AB099321

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

118

2

2368

AB099314

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

119

2

2162

AB099313

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

120

2

179

AB099309

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

121

2

2695

AB099318

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

122

2

2697

AB099319

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

123

2

22

AB099305

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

124

2

LS-G2

FJ808592

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

125

2

LS-Zoo2

FJ808598

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

126

2

PL9006

FJ808591

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

127

2

PL-1457

FJ808583

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

128

2

AL-6114

FJ808579

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

129

2

A2757

AB099322

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

130

2

A2613

AB099317

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

131

2

A2608

AB099316

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

132

2

A96

AB099306

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

133

2

A2060

AB099312

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

134

2

A8086

AB099326

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

135

2

A2699

AB099320

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

136

2

A134

AB099308

444

280/164

399/45

224/220

19S 94/87/32/27/6

198/128/118

8

137

2

A9014

AB099327

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

..

BLV

GenBank

A/N

-

(bp)

- (bp)

K

Pvull

Sspl

Hphl

Hue III

BstW

138

2

8028

AB099325

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

139

2

Arg41

FJ914764

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

140

2

384

AF399704

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

141

2

PL-247

FJ808580

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

142

2

PL-4960

FJ808590

444

280/164

399/45

224/220

198/87/49/45/32/27/6

198/128/118

9

143

2

ARGSF8

AF485773

444

280/164

399/45

444

198/94/87/32/27/6

198/128/118

10

144

2

AL-1453

FJ808577

444

280/164

444

224/220

198/94/87/32/27/6

198/128/118

11

145

3

USCA-1

EF065647

444

444

399/45

444

285/94/32/21/6/6

198/128/96/22

12

146

3

USCA-2

EF065648

444

444

399/45

444

285/94/32/27/6

198/128/96/22

13

147

3

USCA-3

EF065649

444

444

399/45

444

285/94/32/27/6

198/128/96/22

13

148

3

JPFU

EF065650

444

444

399/45

444

285/94/32/27/6

198/128/118

14

149

4

BG

EF065638

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

150

4

N10

HM102355

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

151

4

N72

JF683619

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

152

4

4-2

HM563781

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

153

4

N097

KC886628

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

154

4

5Z

HM563780

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

155

4

4Z

HM563779

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

156

4

5

HM563771

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

157

4

2

HM563772

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

158

4

4

HM563770

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

159

4

1C

JF720354

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

160

4

8C

JF720356

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

161

4

9C

JF720357

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

162

4

1S-C18

JQ353648

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

163

4

1S-C20

JQ353647

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

164

4

1S-C15

JQ353641

444

280 164

399/45

224 220

198 64 87 32 27 6

444

15

165

4

NV 13

JQ686111

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

..

BLV

Gen Ban

A/N

-

()

- ()

Pvull

Sspl

Hphl

III

BstW

166

4

N025

867150

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

167

4

N026

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

168

4

N096

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

169

4

1

563773

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

170

4

21

U87871

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

171

4

02251

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

172

4

AF033818

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

173

4

PL1

AF067081

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

174

4

LB59

35238

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

175

4

LS-SFB

FJ808596

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

176

4

LS-SFA

FJ808595

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

177

4

344

AF503581

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

178

4

LB285

35240

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

179

4

BLVgp-11

AF 111171

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

180

4

27

AY515277

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

181

4

145

AY515275

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

182

4

58

AY515278

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

183

4

96

AY515273

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

184

4

8

AY515279

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

185

4

7

JF720355

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

186

4

1S-C17

JQ353644

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

187

4

lS-

JQ353643

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

188

4

8-Ѳ2

JQ353637

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

189

4

NK4

JQ686118

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

190

4

6

JQ686096

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

191

4

136

JQ686095

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

192

4

1 8 RU

HQ902262

444

280 164

399/45

224 220

198 04 87 32 27 6

444

15

193

4

1 S-c 14

JQ353642

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

..

BLV

Gen Ban

A/N

-

(bp)

- (bp)

K

Pvull

Sspl

Hphl

Hae III

BstW

194

4

NB3

JQ686108

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

195

4

7

JQ686093

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

196

4

1 4 RU

HQ902260

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

197

4

MS9368

JQ686100

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

198

4

MS3630

JQ686099

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

199

4

MS3569

JQ686098

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

200

4

N069

886619

444

280.164

399.45

224.220

198/94/87/32/27/6

444

15

201

4

N072

444

280.164

399.45

224.220

198/94/87/32/27/6

444

15

202

4

4-5

JQ353668

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

203

4

4-6

JQ353659

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

204

4

4-4

JQ353669

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

205

4

4-

JQ353660

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

206

4

4-7

JQ353657

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

207

4

MS3566

JQ686097

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

208

4

563782

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

209

4

6

563783

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

210

4

5233

JQ675758

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

211

4

107

JQ686094

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

212

4

57

JQ686092

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

213

4

45

JQ686091

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

214

4

46

JQ686090

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

215

4

19

JQ686089

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

216

4

lS-cll

JQ353646

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

217

4

R6077

JQ686107

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

218

4

R9884

JQ686105

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

219

4

R6164

JQ686104

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

220

4

NV3

JQ686112

444

280 164

399/45

224 220

198 94 87 32 27 6

444

15

221

4

R6136

JQ686103

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

..

BLV

GenBank

A/N

-

()

- ()

Pvull

Sspl

Hphl

Hue III

BstW

222

4

R5070

JQ686102

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

223

4

R5164

JQ686106

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

224

4

R5036

JQ686101

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

225

4

NV14

JQ686113

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

226

4

4-2

JQ353666

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

227

4

1S-C19

JQ353639

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

228

4

N001

867136

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

229

4

N002

867137

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

230

4

N004

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

231

4

N007

867141

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

232

4

N018

867145

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

233

4

N019

867146

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

234

4

N022

867148

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

235

4

N027

886607

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

236

4

N033

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

237

4

N031

886610

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

238

4

N028

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

239

4

N050

886613

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

240

4

N053

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

241

4

N056

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

242

4

N054

886614

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

243

4

N074

886620

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

244

4

N075

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

245

4

N078

886621

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

246

4

N079

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

247

4

N080

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

248

4

N082

886622

444

280 164

399/45

224 220

198 04 87 32 27 6

444

15

249

4

N084

886623

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

..

BLV

GenBank

A/N

-

()

- ()

Pvull

Sspl

Hphl

Hue III

BstW

250

4

N086

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

251

4

N087

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

252

4

N090

886625

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

253

4

N110

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

254

4

N111

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

255

4

N113

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

256

4

N114

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

257

4

N124

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

258

4

N092

886626

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

259

4

N095

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

260

4

N094

886627

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

261

4

N100

886630

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

262

4

N122

886632

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

263

4

N123

886633

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

264

4

3

U87872

444

444

399/45

224/220

198/94/87/32/27/6

444

16

265

4

1S-C16

JQ353652

444

280/164

399/45

444

198/94/87/32/27/6

444

17

266

4

N015

867143

444

280/164

399/45

444

198/94/87/32/26/6

444

17

267

4

N016

444

280/164

399/45

444

198/94/87/32/26/6

444

17

268

4

N062

886615

444

280/164

399/45

444

198/94/87/32/26/6

444

17

269

4

N127

444

280/164

399/45

444

198/94/87/32/26/6

444

17

270

4

N128

444

280/164

399/45

444

198/94/87/32/26/6

444

17

271

4

N129

444

280/164

399/45

444

198/94/87/32/26/6

444

17

272

4

N130

444

280/164

399/45

444

198/94/87/32/26/6

444

17

273

4

N131

444

280/164

399/45

444

198/94/87/32/26/6

444

17

274

4

N132

444

280/164

399/45

444

198/94/87/32/26/6

444

17

275

4

N134

444

280/164

399/45

444

198/94/87/32/26/6

444

17

276

4

N136

444

280 164

399/45

444

198 64 87 32 26 6

444

17

277

4

N137

444

280/164

399/45

444

198/94/87/32/26/6

444

17

..

BLV

GenBank

A/N

-

- (bp)

(bp)

Pvull

Sspl

Hphl

Hue III

BstW

278

4

N138

444

280/164

399/45

444

198/94/87/32/26/6

444

17

279

4

N139

444

280/164

399/45

444

198/94/87/32/26/6

444

17

280

4

N140

444

280/164

399/45

444

198/94/87/32/26/6

444

17

281

4

N023

KC867149

444

280.164

399/45

224/220

198/94/87/32/27/6

253/191

18

282

4

1 BY

HQ902258

444

280/164

444

224/220

198/94/87/32/27/6

444

19

283

4

2 BY

HQ902259

444

280/164

444

224/220

198/94/87/32/27/6

444

19

284

4

N029

KC886608

444

280/164

444

224/220

198/94/87/32/27/6

444

19

285

4

N083

444

280/164

444

224/220

198/94/87/32/27/6

444

19

286

4

N085

444

280/164

444

224/220

198/94/87/32/27/6

444

19

287

4

N091

444

280/164

444

224/220

198/94/87/32/27/6

444

19

288

4

N030

KC886609

444

280/164

444

224/220

198/94/87/32/27/6

444

19

289

4

N034

KC886611

444

280/164

399/45

224/220

198/121/87/32/6

444

20

290

4

1S-c9

JQ353640

444

280/164

399/45

224/220

198/119/94/27/6

444

21

291

4

NK11

JQ686117

444

280/164

399/45

224/220

285/94/32/27/6

444

22

292

4

70

HM563778

444

280/164

399/45

224/220

285/94/32/27/6

444

22

293

4

107

HM563755

444

280/164

399/45

224/220

285/94/32/27/6

444

22

294

4

67

HM563775

444

280/164

399/45

224/220

285/94/32/27/6

444

22

295

4

65

HM563776

444

280/164

399/45

224/220

285/94/32/27/6

444

22

296

4

NB12

JQ686109

444

280/164

399/45

224/220

285/94/32/27/6

444

22

297

4

lS-clO

JQ353650

444

280/164

399/45

220/145/79

198/94/87/32/27/6

444

23

298

5

CRAS-1

EF065635

444

280/164

399/45

224/181/39

198/94/87/32/27/6

316/128

24

399

5

CRAS-2

EF065636

444

280/164

399/45

224/181/39

198/94/87/32/27/6

316/128

24

300

5

CRLC-2

EF065654

444

280/164

399/45

224/181/39

198/94/87/32/27/6

316/128

24

301

5

8513

AF399702

444

280/164

399/45

224/181/39

198/94/87/32/27/6

316/128

24

302

5

31

DQ059416

444

280/164

399/45

224/181/39

198/94/87/32/27/6

316/128

24

303

5

13

GQ985390

444

280/164

399/45

224/181/39

198/94/87/32/27/6

316/128

24

304

5

CE09/87/SP

JN254634

444

280 164

399 45

224 181 39

19S 94/87/32/27/6

316/128

24

305

5

CRLV

EF065643

444

280/164

399/45

224/181/39

198/94/87/32/27/6

316/128

24

..

BLV

Gen Ban

A/N

-

()

- ()

Pvull

Sspl

Hphl

III

BstW

306

5

CRGC

EF065639

444

280/164

399/45

224/181/39

285/94/32/27/6

316/128

25

307

5

CRLC-1

EF065655

444

280/164

444

224/181/39

198/94/87/32/27/6

316/128

26

308

5

CRAG-1

EF065645

444

280/164

444

224/181/39

198/94/87/32/27/6

316/128

26

309

6

PL-1238

FJ808582

444

444

399/45

224/220

285/94/32/27/6

316/128

27

310

6

29

GQ985391

444

444

399/45

224/220

285/94/32/27/6

316/128

27

311

6

CE09/80/SP

JN254633

444

444

399/45

224/220

285/94/32/27/6

316/128

27

312

6

09/196/

JN254635

444

444

399/45

224/220

285/94/32/27/6

316/128

27

313

6

CE07/04/SP

JN254637

444

444

399/45

224/220

285/94/32/27/6

316/128

27

314

6

CE09/159/SP

JN254638

444

444

399/45

224/220

285/94/32/27/6

316/128

27

315

6

34

DQ059419

444

444

399/45

224/220

285/94/32/27/6

316/128

27

316

6

151

AY185360

444

444

399/45

224/220

198/94/87/32/27/6

316/128

28

317

6

135

AY283061

444

444

399/45

224/220

198/94/87/32/27/6

316/128

28

318

6

89

AY277947

444

444

399/45

224/220

198/94/87/32/27/6

316/128

28

319

6

50

DQ059421

444

444

399/45

224/220

198/94/87/32/27/6

316/128

28

320

6

2

DQ059420

444

444

399/45

224/220

198/94/87/32/27/6

316/128

28

321

6

25

DQ059415

444

444

399/45

224/220

198/94/87/32/27/6

316/128

28

322

6

10

GQ985389

444

444

399/45

224/220

198/94/87/32/27/6

316/128

28

323

6

08/180/SP

JN254639

444

444

399/45

224/220

198/94/87/32/27/6

316/128

28

324

7

N28

102356

444

444

444

224/137/83

198/94/87/32/27/6

294/128/22

29

325

7

N013

867142

444

444

444

224/137/83

198/94/87/32/27/6

294/128/22

29

326

7

N014

444

444

444

224/137/83

198/94/87/32/27/6

294/128/22

29

327

7

N057

444

444

444

224/137/83

198/94/87/32/27/6

294/128/22

29

328

7

N058

444

444

444

224/137/83

198/94/87/32/27/6

294/128/22

29

329

7

N060

444

444

444

224/137/83

198/94/87/32/27/6

294/128/22

29

330

7

N061

444

444

444

224/137/83

198/94/87/32/27/6

294/128/22

29

331

7

176

AY515276

444

444

444

224/137/83

198/94/87/32/27/6

316/128

332

7

1

AY5 15280

444

444

444

224/137/83

198/94/87/32/27/6

316/128

333

7

5

563754

444

444

444

224/137/83

198/94/87/32/27/6

316/128

..

BLV

Gen Ban

A/N

-

- ()

()

Pvull

Sspl

Hphl

III

BstW

334

7

4

563753

444

444

444

224/137/83

198/94/87/32/27/6

316/128

335

1

4

563752

444

444

444

224/137/83

198/94/87/32/27/6

316/128

336

1

3

563751

444

444

444

224/137/83

198/94/87/32/27/6

316/128

337

1

2S

JF720350

444

444

444

224/137/83

198/94/87/32/27/6

316/128

338

1

4-Ѳ6

JQ353665

444

444

444

224/137/83

198/94/87/32/27/6

316/128

339

1

1S-C5

JQ353635

444

444

444

224/137/83

198/94/87/32/27/6

316/128

340

1

NV12

JQ686115

444

444

444

224/137/83

198/94/87/32/27/6

316/128

341

1

NV20

JQ686116

444

444

444

224/137/83

198/94/87/32/27/6

316/128

342

1

N035

886612

444

444

444

224/137/83

198/94/87/32/27/6

316/128

343

1

N064

444

444

444

224/137/83

198/94/87/32/27/6

316/128

344

1

N081

444

444

444

224/137/83

198/94/87/32/27/6

316/128

345

7

N108

444

444

444

224/137/83

198/94/87/32/27/6

316/128

346

7

N116

444

444

444

224/137/83

198/94/87/32/27/6

316/128

347

7

N118

444

444

444

224/137/83

198/94/87/32/27/6

316/128

348

7

N120

444

444

444

224/137/83

198/94/87/32/27/6

316/128

349

7

N125

444

444

444

224/137/83

198/94/87/32/27/6

316/128

350

7

N133

444

444

444

224/137/83

198/94/87/32/27/6

316/128

351

7

4

563757

444

444

444

224/137/83

198/94/87/32/27/6

316/128

352

7

563756

444

444

444

224/137/83

198/94/87/32/27/6

316/128

353

7

2

563750

444

444

444

224/137/83

198/94/87/32/27/6

316/128

354

7

5

563749

444

444

444

224/137/83

198/94/87/32/27/6

316/128

355

7

3

563748

444

444

444

224/137/83

198/94/87/32/27/6

316/128

356

7

3-1

563761

444

444

444

224/137/83

198/94/87/32/27/6

316/128

357

7

3-3

563760

444

444

444

224/137/83

198/94/87/32/27/6

316/128

358

7

3-18

563759

444

444

444

224/137/83

198/94/87/32/27/6

316/128

359

7

3-15

563758

444

444

444

224/137/83

198/94/87/32/27/6

316/128

360

7

160

563763

444

444

444

224/137/83

19S 94/87/32/27/6

316/128

361

7

I 7 RU

HQ902261

444

444

444

224/137/83

198/94/87/32/27/6

316/128

..

BLV

GenBank

A/N

-

- ()

()

Pvull

Sspl

Hphl

Hue III

BstW

362

7

4-Ѳ4

JQ353671

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

363

1

4-Ѳ7

JQ353664

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

364

1

4-Ѳ8

JQ353667

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

365

1

1S-C8

JQ353636

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

366

1

3877

JQ675756

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

367

1

NK13

JQ686119

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

368

1

1S-C2

JQ353638

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

369

1

4-Ѳ5

JQ353653

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

370

1

4-Ѳ

JQ353654

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

371

1

626

JQ675757

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

372

1

N003

867138

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

373

7

N008

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

374

7

N005

867139

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

375

7

N017

867144

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

376

7

N021

867147

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

377

7

N066

886617

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

378

7

N099

886629

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

379

7

N101

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

380

7

N102

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

381

7

N104

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

382

7

N105

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

383

7

N106

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

384

7

12

S83530

444

444

444

224/220

285/94/32/27/6

316/128

31

385

7

14

AY515274

444

444

444

145/137/83/79

198/94/87/32/27/6

316/128

32

386

7

30

DQ059417

444

444

444

444

198/87/49/45/32/27/6

316/128

33

387

7

3S

JF720351

444

280/164

444

224/137/83

198/94/87/32/27/6

316/128

34

388

7

5S

JF720353

444

280 164

444

224/137/83

19S 94/87/32/27/6

316/128

34

389

7

lS-

JQ353645

444

280/164

444

224/137/83

198/94/87/32/27/6

316/128

34

..

BLV

GenBank

A/N

-

(bp)

- (bp)

K

Pvull

Sspl

Hphl

Hue III

BstW

390

7

4-Ѳ9

JQ353655

444

444

399/45

224/137/83

198/94/87/32/27/6

316/128

35

391

7

4-20

JQ353661

444

444

399/45

224/137/83

198/94/87/32/27/6

316/128

35

392

7

4-21

JQ353663

444

444

399/45

224/137/83

198/94/87/32/27/6

316/128

35

393

7

1S-C4

JQ353651

444

444

444

224/137/83

198/94/87/32/27/6

316/79/49

36

394

7

NK17

JQ686120

444

444

444

224/137/83

198/87/49/45/32/27/6

316/128

37

395

7

4-Ѳ2

JQ353662

444

444

444

224/137/83

198/87/49/45/32/27/6

316/128

37

396

7

4S

JF720352

444

444

444

224/137/83

198/119/94/27/6

316/128

38

397

7

IS-

JQ353633

444

444

444

224/137/83

198/121/87/32/6

316/128

39

398

7

4-Ѳ1

JQ353656

444

444

444

224/137/83

285/94/32/27/6

316/128

40

399

7

N067

KC886618

444

444

444

224/137/44/39

198/94/87/32/27/6

316/128

41

400

7

lS-cl

JQ353649

444

444

444

224/220

198/94/87/32/27/6

444

42

401

7

4-1

JQ353658

444

444

444

224/220

198/94/87/32/27/6

444

42

411

8

M1/ELG /08

GU724606

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

412

8

ELG //08

JN990069

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

413

8

ELG /S/08

JN990070

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

414

8

ELG Cro/MIT/09

JN990073

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

415

8

ELG Cro/ORA/09

JN990071

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

406

8

3-43

HM563767

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

407

8

4-1

HM563766

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

408

8

N063

KC886616

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

409

8

N068

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

410

8

2-48

HM563768

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

416

8

N006

KC867140

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

417

8

N009

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

418

8

N089

KC886624

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

402

8

N174

JF713455

444

444

399/45

224/220

225/94/87/32/6

316/128

44

403

8

3511

JQ675760

444

444

399 45

224/220

225/94/87/32/6

316/128

44

404

8

N121

KC886631

444

444

399/45

224/220

225/94/87/32/6

316/128

44

..

BLV

Gen Ban

A/N

-

()

- ()

Pvull

Sspl

Hphl

III

BstW

405

8

N142

886634

444

444

399/45

224/220

225/94/87/32/6

316/128

44

419

8

ELG Cro/VRA/09

JN990072

444

444

444

224/220

225/94/87/32/6

198/128/118

45

420

8

ELG //10

JN990074

444

444

444

224/220

225/94/87/32/6

198/128/118

45

421

8

4-6

563764

444

444

399/45

224/137/83

225/94/87/32/6

198/128/118

46

422

8

2137

JQ675759

444

444

399/45

444

225/94/87/32/6

198/128/118

47

: - ; - .

-- BLV,

'# 9/1 Iff

K/f I/

-

- (bp)

BLV

A/N

(bp)

Pvull

Sspl

Hphl

Hae III

BstW

N

1

AL-63

FJ808571

444

444

399/45

224/220

198/94/87/32/27/6

198/128/118

1

53

1

Cow 527

AF007764

444

444

399/45

224/220

285/94/32/27/6

198/128/118

2

8

1

23

U87873

444

444

399/45

224/220

312/94/32/6

198/128/118

3

1

1

AL-2106

FJ808578

444

444

399/45

224/220

198/94/87/32/27/6

246/198

4

42

1

UruC06II

FM955558

444

444

399/45

224/220

285/94/32/27/6

246/198

5

1

1

VdM

M35239

444

444

399/45

224/181/39

198/94/87/32/27/6

316/128

6

1

1

Kurdistan

EU266062

444

444

399/45

220/196/28

198/119/94/27/6

198/128/118

7

1

2

AL-164

FJ808574

444

280/164

399/45

224/220

198/94/87/32/27/6

198/128/118

8

34

2

PL-4960

FJ808590

444

280/164

399/45

224/220

198/87/49/45/32/27/6

198/128/118

9

1

2

ARGSF8

AF485773

444

280/164

399/45

444

198/94/87/32/27/6

198/128/118

10

1

2

AL-1453

FJ808577

444

280/164

444

224/220

198/94/87/32/27/6

198/128/118

11

1

3

USCA-1

EF065647

444

444

399/45

444

285/94/32/21/6/6

198/128/96/22

12

1

3

USCA-2

EF065648

444

444

399/45

444

285/94/32/27/6

198/128/96/22

13

2

3

JPFU

EF065650

444

444

399/45

444

285/94/32/27/6

198/128/118

14

1

4

BG

EF065638

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

115

4

3

U87872

444

444

399/45

224/220

198/94/87/32/27/6

444

16

1

4

1S-C16

JQ353652

444

280/164

399/45

444

198/94/87/32/27/6

444

17

16

4

N023

KC867149

444

280.164

399.45

224.220

198/94/87/32/27/6

253/191

18

1

4

1 BY

HQ902258

444

280/164

444

224/220

198/94/87/32/27/6

444

19

7

4

N034

KC886611

444

280/164

399/45

224/220

198/121/87/32/6

444

20

1

4

1S-c9

JQ353640

444

280/164

399/45

224/220

198/119/94/27/6

444

21

1

4

NK11

JQ686117

444

280/164

399/45

224/220

285/94/32/27/6

444

22

6

4

lS-clO

JQ353650

444

280/164

399/45

220/145/79

198/94/87/32/27/6

444

23

1

5

CRAS-1

EF065635

444

280/164

399/45

224/181/39

198/94/87/32/27/6

316/128

24

8

5

065639

444

280/164

399/45

224/181/39

285/94/32/27/6

316/128

25

1

5

-1

065655

444

280/164

444

224/181/39

198/94/87/32/27/6

316/128

26

2

6

-1238

3808582

444

444

399/45

224/220

285/94/32/27/6

316/128

27

7

6

151

185360

444

444

399/45

224/220

198/94/87/32/27/6

316/128

28

8

7

N28

102356

444

444

444

224/137/83

198/94/87/32/27/6

294/128/22

29

7

7

176

515276

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

53

7

12

883530

444

444

444

224/220

285/94/32/27/6

316/128

31

1

7

14

515274

444

444

444

145/137/83/79

198/94/87/32/27/6

316/128

32

1

7

30

059417

444

444

444

444

198/87/49/45/32/27/6

316/128

33

1

7

38

720351

444

280/164

444

224/137/83

198/94/87/32/27/6

316/128

34

3

7

4-19

10353655

444

444

399/45

224/137/83

198/94/87/32/27/6

316/128

35

3

7

18-4

10353651

444

444

444

224/137/83

198/94/87/32/27/6

316/79/49

36

1

7

N107

10686120

444

444

444

224/137/83

198/87/49/45/32/27/6

316/128

37

2

7

48

720352

444

444

444

224/137/83

198/119/94/27/6

316/128

38

1

7

18-

30353633

444

444

444

224/137/83

198/121/87/32/6

316/128

39

1

7

4-11

30353656

444

444

444

224/137/83

285/94/32/27/6

316/128

40

1

7

N067

886618

444

444

444

224/137/44/39

198/94/87/32/27/6

316/128

41

1

7

18-1

30353649

444

444

444

224/220

198/94/87/32/27/6

444

42

2

8

1/ /0 8

24606

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

13

8

N174

713455

444

444

399/45

224/220

225/94/87/32/6

316/128

44

4

8

//09

3^90072

444

444

444

224/220

225/94/87/32/6

198/128/118

45

2

8

4-6

563764

444

444

399/45

224/137/83

225/94/87/32/6

198/128/118

46

1

8

2137

30675759

444

444

399/45

444

225/94/87/32/6

198/128/118

47

1

: × ; - ; N - --.

-- N023 (. 2, 14-18) 18- (18) --- 4- , ( ) 1 - ( N023, / 867149).

-- N029, . 3 ( 2-6) 19- ( 19) --- 4- , 7 (. 20), 5 .

-- N034 (. 3, 8-12) 20- (20) --- 4- , ( ) N061 - ( N034, / 886611).

-- N013 (. 3, 14-18) 29- () ---- 7- , 7 (. 20), 2 N061 - ( N28, / 102356; N013, / 867142).

-- : N067 (41- 7- ), N006 N142 (43- 44- 8- ) . 4.

5 (, &/?1, , III ${1) --- . 5.1-5.6.

( -1.13).

100 . 21.

  • 444 399
  • 100 50
  • 94/87
  • 45
  • 32 27

. 2. -- N031, N015 N023 ( )

  • 1000
  • 700
  • 500 400
  • 300 200
  • 280 253
  • 224/220 198/191 164

: 1, 7, 13) - 100 + 50 (). 2-6) -- N031 (15, 4- ): 2) ˲- (280/164 ); 3) &/- (399/45 ); 4) - (224/220 ); 5) - (198/94/87/32/27/6 ); 6) ^Ӳ- (444 ). 812) -- N015 (17, 4- ): 8) ˲- (280/164 ); 9) &/- (399/45 ); 10) - (444 ); 11) 1- (198/94/87/32/27/6 ); 12) &?1- (444 ). 14-18) -- N023 (18, 4- ): 14) - (280.164 ); 15) 5^1- (399/45 ); 16) - (224/220 ); 17) - (198/94/87/32/27/6 ); 18) 55/Ӳ- (253/191 ).

  • 444 399
  • 100
  • 50
 --    N029, N034  N013 (   )

. 3. -- N029, N034 N013 ( )

  • 1000 700
  • 500 400
  • 300 200
  • 294 280 224/220 198
  • 164
  • 137/128 121
  • 94/87 83 1

: 1, 7, 13) - 100 + 50 (). 2-6) -- N029 (19, 4- ): 2) 쳳- (280/164 ); 3) %?1- (444 ); 4) - (224/220 ); 5) - (198/94/87/32/27/6 ); 6) Ӳ- (444 ). 8-12) -- N034 (20, 4- ): 8) 쳳- (280/164 ); 9) &/- (399/45 ); 10) /?1- (224/220 ); 11) - (198/121/87/32/6 ); 12) '- (444 ). 14-18) -- N013 (29, 7- ): 14) 쳳- (444 ); 15) &/- (444 ); 16) ˲- (224/137/83 ); 17) - (198/94/87/32/27/6 ); 18) 5/Ӳ- (294/128/22 ).

  • 1000
  • 700
  • 500 400
  • 300
  • 200
  • 100 50
 --    N067, N006  N142 (   )

. 4. -- N067, N006 N142 ( )

  • 444 399
  • 316
  • 225/224/220 198
  • 137/128 118 94/87
  • 45/44/39 32/27

: 1, 7, 13) - 100 + 50 (). 2-6) -- N067 (41, 7- ): 2) /- (444 ); 3) &/- (444 ); 4) - (224/137/44/39 ); 5) - (198/94/87/32/27/6 ); 6) Ӳ- (316/128 ). 8-12) -- N006 (43, 8- ): 8) - (444 ); 9) &/- (399/45 ); 10) /- (224/220 ); 11) - (225/94/87/32/6 ); 12) ^/Ӳ- (198/128/118 ). 1418) -- N142 (44, 8- ): 14) 첲- (444 ); 15) &1- (399/45 ); 16) - (224/220 ); 17) - (225/94/87/32/6 ); 18) - (316/128 ).

  • 500 -
  • 100 -
  • 1000 -
  • 500 -
  • 100 -
  • 12 3 4

1 1 1 1

貲 8 岲 Ӳ 볲 81 ) 岲 Ӳ 岲 $Ӳ 볲 8 ^) 岲 Ӳ

  • - 500
  • - 100
  • 7 1000
  • - 500
  • - 100

5

6

7

8

1

1

1

2

貲 8 岲 Ӳ

ಲ $$ 岲 Ӳ

ﳿ 8 岲 Ӳ

ﳿ 8 ^ 岲 Ӳ

  • 500 -
  • 100 -
  • - 500
  • - 100
  • 13 14 15 16

Genotype 3 Genotype 3 Genotype 4 Genotype 4

narker PvuII SspI HphI Haelll BstYI PvuII SspI HphI HaelH BstYI PvuII SspI HphI Haelll BstYI PvuII SspI HphI HaelH BstYI narker

  • 1000 -
  • 500 -
  • 100 -

1000

  • - 500
  • - 100
  • 500 -
  • 100 -
  • - 500
  • - 100

21

22

23

24

Genotype 4

Genotype 4

Genotype 4

Genotype 5

narker PvuII SspI HphI Haelll BstYI

PvuII SspI HphI Haelll BstYI

PvuII SspI HphI Haelll BstYI

Pv'uII SspI HphI Haelll BstYI narker

  • 1000 -
  • 500 -
  • 100 -

1000

  • - 500
  • - 100
  • 500 -
  • 100 -
  • - 500
  • - 100

29

30

31

32

7

1 7

7

1 7

! 4) *11

8$1 511

81 ) 11

*11

  • 1000 -
  • 500 -
  • 100 -

1000

  • - 500
  • - 100
  • 500 -
  • 100 -
  • - - 1000
  • - 500
  • - 100

37

3S

39

40

Genotype 7

Genotype 7

Genotype 7

Genotype 7

narker Pv-uII SspI HphI Haelll BstYI

Pv-uII SspI HphI Haelll BstYI

PvuII SspI HphI Haelll BstYI

PvuII SspI HphI Haelll BstYI narker

  • 1000 -
  • 500 -
  • 100 -

1000

  • - 500
  • - 100
  • 41 42 43 44

7 7 8 8

11 8 ! ^) *11 81 *11 81 $11 8! ) *11

  • 500 -
  • 100 -
  • - 500
  • -100

8

11 8$1 511

8

! 4) *11

8

81 ) *11

  • 1000 -
  • 500 -
  • 100 -

  • - 500
  • - 100

BLV AL-63 Cow 527 23

AL-2106

UruC06II

VdM

Kurdistan

AL-164

PL-4960

ARGSF8

AL-1453

USCA-1

USCA-2

JPFU

BG

1S-C16

N023

1_BY

N034

1S-c9

NK11

lS-clO

CRAS-1

CRGC

CRLC-1

PL-1238

151

N28

  • 12
  • 30
  • 3S
  • 4T-cl9
  • 1S-c4

NK17

  • 4S
  • 1S-c6
  • 4T-cll

N067

lS-cl

ELG_Cro/08

N174

Cro/VRA/09

4-6

MKC2137

  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001
  • 001

env5099_

CCCACAAGGGCGGCGCCGGTTT Haelll

CCCACAAGGGCGGCGCCGGTTTGGAGCCAGGGCCATGGTCACATATGATT

A

A

A

A

T

? ?? ?????? ????? ?? ??????? ? ieie ? ??????????

AL-63

051

Cow 527

051

23

051

AL-2106

051

UruC06lI

051

VdM

051

Kurdistan

051

AL-164

051

PL-4960

051

ARGSF8

051

AL-1453

051

USCA-1

051

USCA-2

051

JPFU

051

BG

051

3

051

1S-C16

051

N023

051

1_BY

051

N034

051

1S-c9

051

NK11

051

lS-clO

051

CRAS-1

051

CRGC

051

CRLC-1

051

PL-1238

051

151

051

N28

051

176

051

12

051

14

051

30

051

3S

051

4T-cl9

051

1S-C4

051

NK17

051

4S

051

1S-c6

051

4T-cll

051

N067

051

lS-cl

051

ELG Cro/08

051

N174

051

Cro/VRA/09

051

4-6

051

MKC2137

051

GCGAGCCCCGATGCCCTTATGTGGGGGCAGATCGCTTCGACTGCCCCCAC

..................................G...............

A

A

A

A

A

A

A

A

A

T

A

?????????? ????? ?? ????? ??????? ????? ?? ??????

BLV

AL-63

101

Cow 527

101

23

101

AL-2106

101

UruCO?II

101

VdM

101

Kurdistan

101

AL-164

101

PL-4960

101

ARGSF8

101

AL-1453

101

USCA-1

101

USCA-2

101

JPFU

101

BG

101

3

101

1S-C16

101

N023

101

1 BY

101

N034

101

1S-c9

101

NK11

101

lS-clO

101

CRAS-1

101

CRGC

101

CRLC-1

101

PL-1238

101

151

101

N28

101

176

101

12

101

14

101

30

101

3S

101

4T-cl9

101

1S-C4

101

NK17

101

4S

101

1S-c6

101

4T-cll

101

N067

101

lS-cl

101

ELG Cro/08

101

N174

101

Cro/VRA/09

101

4-6

101

MKC2137

101

HaelII

B s tYI

Hphl.

101 TGGGACAATGCCTCCCAGGCCGATC6AGGATCCTTTTATGTCAATCATCA

.A........................

.A........................

.A.'

.A.

. A. _

.ag

.A."

.a/

.A."

.A.

.A.

.A."

.A.

.A.

.A.

.A.

.A.

.A.

.A.

.A.

.A.

.A.

. A. _

.A."

.A."

T. A

T

T

A

A

A

T

G

G

G

G

G

G

G

G

G

G

G

G

G

G

G

G

C

C

C

G.A G. .

AT.... AG

____AG'

_______a/

____A/

.T____A."

_______A.

___. . . .A/

____A/

____A/

____A/

____A/

____A/

____A/

T.....A.'

_______A.'

____A/

____A. _

____AG^

____A/

____A/

......A.'

  • **
  • ???? ????? ? ?
  • ? ? ?
  • ?[1] **??**?[1] * [1] ***
  • ? ?

BsfcYI Hphl_

BLV

AL-63

151

Cow 527

151

23

151

AL-2106

151

UruCO?II

151

VdM

151

Kurdistan

151

AL-164

151

PL-4960

151

ARGSF8

151

AL-1453

151

USCA-1

151

USCA-2

151

JPFU

151

BG

151

3

151

1S-C16

151

N023

151

1 BY

151

N034

151

1S-c9

151

NK11

151

lS-clO

151

CRAS-1

151

CRGC

151

CRLC-1

151

PL-1238

151

151

151

N28

151

176

151

12

151

14

151

30

151

3S

151

4T-cl9

151

1S-C4

151

NK17

151

4S

151

1S-c6

151

4T-cll

151

N067

151

lS-cl

151

ELG Cro/08

151

N174

151

Cro/VRA/09

151

4-6

151

MKC2137

151

..........A..........G

C.....................

c.....................

c.....................

GATTTTATTCCTGCATCTCAAACAATGTCATGGAATTTTCACTCTAACCT

C..................................

c..................................

..................................c

........................................T

........................................T

........................................T

........................................T

.......................................

.......................................

......T..................................

c

T

G

C. .G

C.......T

.C. . . .C....................................G. . . .

...........................................G. . ..

.............G..................................

...........................................G. . ..

..........A.....T.............................T.

...........................................G. . . .

...........................................G. . . .

...........................................G. . . .

...........................................G.. ..

...........................................G. . ..

...........................................G. . ..

...........................................G. . ..

........................................C.......

C...............................................

BLV

Hphl

BstYI

AL-63

201

GGGAGATATGGGGATATGATCCCCTGATCACCTTTTCTTTACATAAGATC

Cow 527

201

23

201

AL-2106

201

UruCO?II

201

VdM

201

..........T

Kurdistan

201

........AA. . .

. . .C.........

AL-164

201

. . . .A........

......c......

PL-4960

201

. . . .A........

......c......

ARGSF8

201

. . . .A........

......c......

.c...........

AL-1453

201

. . . .A........

......c......

USCA-1

201

. . . .A........

.....G.......

USCA-2

201

. . . .A........

.....G.......

JPFU

201

. . . .A........

.....G.......

BG

201

. . . .A........

.......A. .T

3

201

. . . .A........

.......A. .T

1S-C16

201

. . . .A........

. . .G.........

.......A. . .

N023

201

. . . .A........

.......A. . .

1 BY

201

. . . .A........

.......A. . .

N034

201

. . . .A........

.......A. . .

1S-c9

201

. . . .A........

.......A. . .

NK11

201

. . . .A........

.......A. . .

lS-clO

201

. . . .A........

.......A. . .

CRAS-1

201

.......A. . .

CRGC

201

.......A. . .

CRLC-1

201

.......A. . .

PL-1238

201

____A........

.......A. . .

151

201

... .A........

.......A. . .

N28

201

... .A........

......c......

.......A. . .

176

201

... .A........

......c......

.......A. . .

12

201

... .A........

......c......

.......A. . .

14

201

... .A........

......c......

.......A. . .

30

201

... .A........

......c......

. .T..........

....C..A...

3S

201

... .A........

......c......

.......A. . .

4T-cl9

201

... .A........

......c......

.......A. . .

1S-C4

201

... .A........

......c......

.......A. . .

NK17

201

... .A........

......c......

.......A. . .

4S

201

... .A........

......c......

........C. . . .

.......A. . .

1S-c6

201

... .A........

......c....c.

.......A. . .

4T-cll

201

... .A........

......c......

.......A. . .

N067

201

... .A........

......c......

.......A. . .

lS-cl

201

.... A... C ... .

......c......

.......A. . .

ELG Cro/08

201

... .A........

N174

201

... .A........

......G. . .T

Cro/VRA/09

201

... .A........

4-6

201

... .A........

MKC2137

201

... .A........

.....T.......

???? ??? ?????? ?? ???? ?? ? ?? ???????? ? ??

BLV

BstYIHphl

PvuII HphI

AL-63

251

CCTGATCCCCCTCAACCCGACTTTCCCCAGTTGAACAGTGACTGGGTTCC

Cow 527

251

23

251

AL-2106

251

UruC06II

251

VdM

251

Kurdistan

251

........ .......

.....

....................

AL-164

251

......

...

....................

PL-4960

251

......

...

....................

ARGSF8

251

.....

...

....................

AL-1453

251

......

...

....................

USCA-1

251

......

...

USCA-2

251

......

...

JPFU

251

......

...

BG

251

......

...

....................

3

251

......

...

...................

1S-C16

251

......

...

....................

N023

251

. .G..............

......

...

....................

1 BY

251

......

...

....................

N034

251

...

....................

1S-c9

251

......

...

....................

NK11

251

......

...

....................

lS-clO

251

......

...

......G.............

CRAS-1

251

................

......

...

....................

CRGC

251

................

......

...

....................

CRLC-1

251

................

......

...

....................

PL-1238

251

......

...

151

251

......

...

N28

251

......

...

176

251

......

...

12

251

......

...

14

251

......

...

.......G.............

30

251

. ...............

......

...

3S

251

......

...

....................

4T-cl9

251

......

...

1S-C4

251

......

...

NK17

251

......

...

4S

251

................

......

...

1S-c6

251

......

...

4T-cll

251

......

...

N067

251

......

...

lS-cl

251

......

...

ELG Cro/08

251

......

...

N174

251

......

...

Cro/VRA/09

251

......

...

4-6

251

......

...

MKC2137

251

......

...

? ? ?? ?????

??? ? ?? ??

? ??? ?????????????

1.6.

5099 552 1 V- []

-63

Cow 527

  • 301
  • 301

23

301

.................................................

-2106 301

301

1

301

Kurdistan

301

...... .

-164

301

.. ..

^......

-4960

301

.. ..

.......

58

301

.. ..

.......

-1453

301

.. ..

.......

-1

301

......

-

301

.......

JPFU

301

.......

301

.......

3

301

13-16

301

.......

N023

301

.......

1

301

.......

N034

301

.......

......

13-9

301

..............................

11

301

..............................

13-

301

. ..

.......

-1

301

.....

.......

301

.....

.......

-1

301

........

.... .

.......

-1238

301

..............................

151

301

..............................

N28

301

..............................

176

301

..............................

12

301

..............................

14

301

..............................

30

301

..............................

301

..............................

4-19

301

..............................

13-4

301

..............................

NK17

301

..............................

43

301

.....

.......

13-

301

..

.......

......

4-11

301

..............................

N067

301

.......

13-1

301

.......

/08

301

... .

.......

N174

301

........

... .

.......

//

301

... .

......

4-6

301

... .

.......

2137

301

... .

.......

?? ??? ?? ??????? ?? ?? ??????? ?? ? ???? ????

BLV

AL-63

Cow 527

HaelII Sspl

351 CAGACTGTGCTATATGTTGGGAACCTTCCCCTCCCTGGGCTCCCGAAATA 351 ..................................................

23

351 ...........

.................

AL-2106

351 ...........

UruC06II

351 ...........

VdM

351 ...........

Kurdistan

351 ...........

AL-164

351 ...........

PL-4960

351 ...........

................ .

ARGSF8

351 ...........

AL-1453

351 ...........

USCA-1

351 ..........

...........G. .

USCA-2

351 ..........

...........G. .

JPFU

351 ..........

...........G. .

BG

351 ...........

3

351 ...........

1S-C16

351 ...........

N023

351 ...........

1 BY

351 ...........

N034

351 ...........

1S-c9

351 ...........

NK11

351 ...........

lS-clO

351 ...........

CRAS-1

351 ...........

CRGC

351 ...........

CRLC-1

351 ...........

. G. . .

PL-1238

351 ...........

151

351 ...........

N28

351 ...........

.G. . .

176

351 ...........

.G. . .

12

351 ...........

.. ...............

.G. . .

14

351 ...........

.

.G. . .

30

351 ...........

.................

.G. . .

3S

351 ...........

.G. . .

4T-cl9

351 ...........

1S-C4

351 ...........

.G. . .

NK17

351 ...........

.................

.G. . .

4S

351 ...........

.G. . .

1S-c6

351 ...........

.G. . .

4T-cll

351 ..........

.G. . .

N067

351 ...........

.G. . .

lS-cl

351 ...........

.G. . .

ELG Cro/08

351 ...........

.

N174

351 ...........

.

Cro/VRA/09

351 ...........

G.................

.

4-6

351 ...........

.

MKC2137

351 ...........

.. ...............

.

***** ****

*********** **

** *** ******* **

* ***

1.8.

5099 552 1 V- []

5521

BLV

AL-63

Cow 527

23

AL-2106

UruC06lI

VdM

Kurdistan

AL-164

PL-4960

CCAGCTCTGGACCCGGCCTCGC

  • 401 TTAGTATATAACAAAACCATCTCCAGCTCTGGACCCGGCCTCGC
  • 401 ............................................
  • 401 ............................................
  • 401 ............................................
  • 401 ............................................
  • 401 ............................................
  • 401 ............................................
  • 401 ............................................
  • 401 . .G.......................T.................

ARGSF8

401 ....

AL-1453

401 G...

USCA-1

401 ....

USCA-2

401 ....

JPFU

401 ....

BG

401 ....

.....................T.

3

401 ....

..................T..T.

1S-C16

401 ....

N023

401 ....

1 BY

401 C...

N034

401 ....

1S-c9

401 ....

NK11

401 ....

lS-clO

401 ....

.....................T.

CRAS-1

401 ....

.T.....

.....................T.

CRGC

401 ....

.T.....

.....................T.

CRLC-1

401 ....

.T.....

.....................T.

PL-1238

401 ....

151

401 ....

N28

401 ....

....C.

176

401 ....

....C.

12

401 ....

.....................T.

14

401 ....

....C.

30

401 ....

.G..C.

3S

401 ....

....C.

4T-cl9

401 ....

....C.

.....................T.

1S-c4

401 ....

....C.

.....................T.

NK17

401 ....

....C.

.....................T.

4S

401 ....

....C.

1S-c6

401 ....

....C.

.....................T.

4T-cll

401 ....

....C.

.....................T.

N067

401 ____

....C.

lS-cl

401 ....

....C.

.....................T.....

ELG Cro/08

401 ....

............c..............

N174

401 ....

Cro/VRA/09

401 C...

.....T......c..............

4-6

401 ....

MKC2137

401 ____

............c..............

? ?? ?? ?? ?????????? ??? ?? ????? ?? ?????

BLV

-

GenBank

A/N

-]

-

AL-63

444

bp

FJ808571

1

1- :

Cow 527

444

bp

AF007764

1

2- :

23

444

bp

U87873

1

3- :

AL-2106

444

bp

FJ808578

1

4- :

UruCO?II

444

bp

FM955558

1

5- :

VdM

444

bp

M35239

1

6- :

Kurdistan

444

bp

EU266062

1

7- :

AL-164

444

bp

FJ808574

2

8- :

PL-4960

444

bp

FJ808590

2

9- :

ARGSF8

444

bp

AF485773

2

10-

AL-1453

444

bp

FJ808577

2

11-

USCA-1

444

bp

EF065647

3

12-

USCA-2

444

bp

EF065648

3

13-

JPFU

444

bp

EF065650

3

14-

BG

444

bp

EF065638

4

15-

3

444

bp

U87872

4

16-

1S-C16

444

bp

JQ353652

4

17-

N023

444

bp

KC867149

4

18-

1 BY

444

bp

HQ902258

4

19-

N034

444

bp

KC886611

4

20-

1S-c9

444

bp

JQ353640

4

21-

NK11

444

bp

JQ686117

4

22-

lS-clO

444

bp

JQ353650

5

23-

CRAS-1

444

bp

EF065635

5

24-

CRGC

444

bp

EF065639

5

25-

CRLC-1

444

bp

EF065655

5

26-

PL-1238

444

bp

FJ808582

6

27-

151

444

bp

AY185360

6

28-

N28

444

bp

HM102356

7

29-

176

444

bp

AY51527 6

7

30-

12

444

bp

S83530

7

31-

14

444

bp

AY515274

7

32-

30

444

bp

DQ059417

7

33-

3S

444

bp

JF720351

7

34-

4T-cl9

444

bp

JQ353655

7

35-

1S-C4

444

bp

JQ353651

7

36-

NK17

444

bp

JQ686120

7

37-

4S

444

bp

JF720352

7

38-

1S-c6

444

bp

JQ353633

7

39-

4T-cll

444

bp

JQ353656

7

40-

N067

444

bp

KC886618

7

41-

lS-cl

444

bp

JQ35364 9

7

42-

ELG Cro/08

444

bp

GU724606

8

43-

N174

444

bp

JF713455

8

44-

Cro/VRA/09

444

bp

JN990072

8

45-

4-6

444

bp

HM563764

8

4 6-

MKC2137

444

bp

JQ675759

8

47-

BLV

PvuII-

Sspl-

Hphl-

AL-63

1-444

1-399/400-444

1-220/221-444

Cow 527

1-444

1-399/400-444

1-220/221-444

23

1-444

1-399/400-444

1-220/221-444

AL-2106

1-444

1-399/400-444

1-220/221-444

UruCO?II

1-444

1-399/400-444

1-220/221-444

VdM

1-444

1-399/400-444

1-181/182-220/221-444

Kurdistan

1-444

1-399/400-444

1-220/221-248/249-444

AL-164

1-280/281-444

1-399/400-444

1-220/221-444

PL-4960

1-280/281-444

1-399/400-444

1-220/221-444

ARGSF8

1-280/281-444

1-399/400-444

1-444

AL-1453

1-280/281-444

1-444

1-220/221-444

USCA-1

1-444

1-399/400-444

1-444

USCA-2

1-444

1-399/400-444

1-444

JPFU

1-444

1-399/400-444

1-444

BG

1-280/281-444

1-399/400-444

1-220/221-444

3

1-444

1-399/400-444

1-220/221-444

1S-C16

1-280/281-444

1-399/400-444

1-444

N023

1-280/281-444

1-399/400-444

1-220/221-444

1 BY

1-280/281-444

1-444

1-220/221-444

N034

1-280/281-444

1-399/400-444

1-220/221-444

1S-c9

1-280/281-444

1-399/400-444

1-220/221-444

NK11

1-280/281-444

1-399/400-444

1-220/221-444

lS-clO

1-280/281-444

1-399/400-444

1-220/221-299/300-444

CRAS-1

1-280/281-444

1-399/400-444

1-181/182-220/221-444

CRGC

1-280/281-444

1-399/400-444

1-181/182-220/221-444

CRLC-1

1-280/281-444

1-444

1-181/182-220/221-444

PL-1238

1-444

1-399/400-444

1-220/221-444

151

1-444

1-399/400-444

1-220/221-444

N28

1-444

1-444

1-137/138-220/221-444

176

1-444

1-444

1-137/138-220/221-444

12

1-444

1-444

1-220/221-444

14

1-444

1-444

1-137/138-220/221-299/300-444

30

1-444

1-444

1-444

3S

1-280/281-444

1-444

1-137/138-220/221-444

4T-cl9

1-444

1-399/400-444

1-137/138-220/221-444

1S-C4

1-444

1-444

1-137/138-220/221-444

NK17

1-444

1-444

1-137/138-220/221-444

4S

1-444

1-444

1-137/138-220/221-444

1S-c6

1-444

1-444

1-137/138-220/221-444

4T-cll

1-444

1-444

1-137/138-220/221-444

N067

1-444

1-444

1-137/138-181/182-220/221-444

lS-cl

1-444

1-444

1-220/221-444

ELG Cro/08

1-444

1-399/400-444

1-220/221-444

N174

1-444

1-399/400-444

1-220/221-444

Cro/VRA/09

1-444

1-444

1-220/221-444

4-6

1-444

1-399/400-444

1-137/138-220/221-444

MKC2137

1-444

1-399/400-444

1-444

BLV HaelII-

AL-63 Cow 527 23

AL-2106

UruC06II

VdM

Kurdistan

AL-164

PL-4960

ARGSF8

AL-1453

USCA-1

USCA-2

JPFU

BG

1S-C16

N023

1_BY

N034

1S-c9

NK11

1S-c10

CRAS-1

CRGC

CRLC-1

PL-1238

151

N28

  • 12
  • 30
  • 3S
  • 4T-cl9
  • 1S-c4

NK17

  • 4S
  • 1S-c6
  • 4T-cll

N067

lS-cl

ELG_Cro/08

N174

Cro/VRA/09

4-6

MKC2137

  • -444
  • -444
  • 438/439-444
  • 444
  • 444
  • 444
  • 444
  • 444
  • -444
  • 444
  • 444
  • 438/439-444
  • 444
  • 438/439-444
  • 1-32/33-119/120-317/318-344/345-438/439-444 1-32/33-317/318-344/345-438/439-444 1-32/33-344/345-438/439-444 1-32/33-119/120-317/318-344/345-438/439 1-32/33-317/318-344/345-438/439-444 1-32/33-119/120-317/318-344/345-438/439 1-119/120-317/318-344/345-438/439-444 1-32/33-119/120-317/318-344/345-438/439 1-32/33-119/120-317/318-344/345-389/390 1-32/33-119/120-317/318-344/345-438/439 1-32/33-119/120-317/318-344/345-438/439 1-32/33-317/318-338/339-344/345-438/439 1-32/33-317/318-344/345-438/439-444 1-32/33-317/318-344/345-438/439-444 1-32/33-119/120-317/318-344/345-438/439 1-32/33-119/120-317/318-344/345-438/439 1-32/33-119/120-317/318-344/345-438/439 1-32/33-119/120-317/318-344/345-438/439 1-32/33-119/120-317/318-344/345-438/439 1-32/33-119/120-317/318-438/439-444 1-119/120-317/318-344/345-438/439-444 1-32/33-317/318-344/345-438/439-444 1-32/33-119/120-317/318-344/345-438/439 1-32/33-119/120-317/318-344/345-438/439 1-32/33-317/318-344/345-438/439-444 1-32/33-119/120-317/318-344/345-438/439 1-32/33-317/318-344/345-438/439-444 1-32/33-119/120-317/318-344/345-438/439 1-32/33-119/120-317/318-344/345-438/439 1-32/33-119/120-317/318-344/345-438/439 1-32/33-317/318-344/345-438/439-444 1-32/33-119/120-317/318-344/345-438/439 1-32/33-119/120-317/318-344/345-389/390 1-32/33-119/120-317/318-344/345-438/439 1-32/33-119/120-317/318-344/345-438/439 1-32/33-119/120-317/318-344/345-438/439 1-32/33-119/120-317/318-344/345-389/390 1-119/120-317/318-344/345-438/439-444 1-32/33-119/120-317/318-438/439-444 1-32/33-317/318-344/345-438/439-444 1-32/33-119/120-317/318-344/345-438/439-444 1-32/33-119/120-317/318-344/345-438/439-444 1-32/33-119/120-344/345-438/439-444 1-32/33-119/120-344/345-438/439-444 1-32/33-119/120-344/345-438/439-444 1-32/33-119/120-344/345-438/439-444 1-32/33-119/120-344/345-438/439-444

BLV AL-63 Cow 527 23

AL-2106

UruC06II

VdM

Kurdistan

AL-164

PL-4960

ARGSF8

AL-1453

USCA-1

USCA-2

JPFU

BG

1S-C16

N023

1_BY

N034

1S-c9

NK11

1S-c10

CRAS-1

CRGC

CRLC-1

PL-1238

151

N28

  • 12
  • 30
  • 3S
  • 4T-cl9
  • 1S-c4

NK17

  • 4S
  • 1S-c6
  • 4T-cll

N067

lS-cl

ELG_Cro/08

N174

Cro/VRA/09

4-6

MKC2137

BsfcYI-

  • 1-128/129-246/247-444
  • 1-128/129-246/247-444
  • 1-128/129-246/247-444
  • 1-246/247-444
  • 1-246/247-444
  • 1-128/129-444
  • 1-128/129-246/247-444
  • 1-128/129-246/247-444
  • 1-128/129-246/247-444
  • 1-128/129-246/247-444
  • 1-128/129-246/247-444
  • 1-128/129-150/151-246/247-444
  • 1-128/129-150/151-246/247-444
  • 1-128/129-246/247-444
  • 1-444
  • 1-444
  • 1-444
  • 1-253/254-444
  • 1-444
  • 1-444
  • 1-444
  • 1-444
  • 1-444
  • 1-128/129-444
  • 1-128/129-444
  • 1-128/129-444
  • 1-128/129-444
  • 1-128/129-444
  • 1-128/129-150/151-444
  • 1-128/129-444
  • 1-128/129-444
  • 1-128/129-444
  • 1-128/129-444
  • 1-128/129-444
  • 1-128/129-444
  • 1-79/80-128/129-444
  • 1-128/129-444
  • 1-128/129-444
  • 1-128/129-444
  • 1-128/129-444
  • 1-128/129-444
  • 1-444
  • 1-128/129-246/247-444
  • 1-128/129-444
  • 1-128/129-246/247-444
  • 1-128/129-246/247-444
  • 1-128/129-246/247-444

/?- 47 8 , --, . 6.

8/102356/1 7

  • 14/515274/1 7
  • 176/515276/17

;720352^1 7

  • -18-60353633/ 7
  • -38/1720351/1 7
  • - 18-4/.0353651 / 7 117/686120/21 7
  • 4- 19>353655/1 7 4-1 0353656/1 7

N067/8X886618^1 7

  • 3 /? 5 9417/( 7
  • 18-353649^1 7 12/883530/1 7

.-1/065655^1 5

I

- 1/065635/1 5 /06539/1 5

  • --1238/*1808582/21 6
  • 151/185360/21 6
  • - 18-16/35352/1 4
  • - 15-0353640/21 4
  • - 11/30686117/^1 4
  • -15-1010353650/2 4
  • -N023/867149/1 4
  • 14034/886611/ 4
  • 1 /902258^14

/065638^^ 4

_ 87872/21 4 -4960/3808590/ 2

- 1453/.1808577/21 2

-164/3808574/1 2

88/485773^1 2

  • 8
  • 4-6/563764/1 8

N 74//713455/{*1 8

2137/675759/1 8

/ /08/7246()6/1 8

- /11/09/9%072/ 8

,/()65650/1 3

-2106/.1808578/1 1 06/95555

  • 8-1/065647/1 3 8-2/065648/1 3
  • -1/11266062/1 1

1/35239/21 1 Cow 52 7/007764˒1 1

/ 1

63/3808571/1 1 -23/87873/1 1

0.005

. 6. 47 8 , - [-4: N3, 400 47 scq.]

, . . . ____ ___

/

-

()

- ()

II

Sspl

III

4

N097

886628

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

4

N025

867150

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

N026, N096

4

N069

886619

444

280.164

399.45

224.220

198/94/87/32/27/6

444

15

N072

4

N001

867136

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

4

N002

867137

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

N004

4

N007

867141

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

4

N018

867145

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

4

N019

867146

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

4

N022

867148

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

4

N027

886607

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

N033

4

N031

886610

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

N028

4

N050

886613

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

N053, N056

4

N054

886614

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

4

N074

886620

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

N075

4

N078

886621

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

N079, N080

4

N082

886622

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

4

N084

886623

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

N086, N087

4

N090

886625

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

N110,N111,N113, N114, N124

4

N092

886626

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

N095

4

N094

886627

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

4

N100

886630

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

4

N122

886632

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

4

N123

886633

444

280/164

399/45

224/220

198/94/87/32/27/6

444

15

4

N015

867143

444

280/164

399/45

444

198/94/87/32/26/6

444

17

N016

BLV

GenBank

A/N

-

()

- ()

BLV

PvuW

Sspl

Hphl

III

BstW

4

N062

886615

444

280/164

399/45

444

198/94/87/32/26/6

444

17

N127-N132, N136-N140, N134

4

N023

867149

444

280.164

399/45

224/220

198/94/87/32/27/6

253/191

18

4

N029

886608

444

280/164

444

224/220

198/94/87/32/27/6

444

19

N083, N085, N091

4

N030

886609

444

280/164

444

224/220

198/94/87/32/27/6

444

19

4

N034

886611

444

280/164

399/45

224/220

198/121/87/32/6

444

20

7

N013

867142

444

444

444

224/137/83

198/94/87/32/27/6

294/128/22

29

N014, N057, N058, N060, N061

7

N035

886612

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

N064, N081, N108, N116,N118,N120, N125, N133

7

N003

867138

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

N008

7

N005

867139

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

7

N017

867144

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

7

N021

867147

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

7

N066

886617

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

7

N099

886629

444

444

444

224/137/83

198/94/87/32/27/6

316/128

30

N101, N102, N104-N106

7

N067

886618

444

444

444

224/137/44/39

198/94/87/32/27/6

316/128

41

8

N063

886616

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

N068

8

N006

867140

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

N009

8

N089

886624

444

444

399/45

224/220

225/94/87/32/6

198/128/118

43

8

N121

886631

444

444

399/45

224/220

225/94/87/32/6

316/128

44

8

N142

886634

444

444

399/45

224/220

225/94/87/32/6

316/128

44

8

N174

JF713455

444

444

399/45

224/220

225/94/87/32/6

316/128

44

N174

: - ; - --.

  • [1] ? ieieieie ie ieie ?? ???? ?????????????????? ? ? ? ?
  • [2] ? ieieieie ie ieie ?? ???? ?????????????????? ? ? ? ?
  • [3] ? ieieieie ie ieie ?? ???? ?????????????????? ? ? ? ?
 
       >